forward primer 27f Search Results


90
STAB VIDA forward primer 27f
Forward Primer 27f, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f/product/STAB VIDA
Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc 27f-illumina forward primer
27f Illumina Forward Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/27f-illumina forward primer/product/Illumina Inc
Average 90 stars, based on 1 article reviews
27f-illumina forward primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pacific Biosciences forward primer 27f 5′- agrgttygatymtggctcag- 3′
Forward Primer 27f 5′ Agrgttygatymtggctcag 3′, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f 5′- agrgttygatymtggctcag- 3′/product/Pacific Biosciences
Average 90 stars, based on 1 article reviews
forward primer 27f 5′- agrgttygatymtggctcag- 3′ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Macrogen forward primer 27f
Forward Primer 27f, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f/product/Macrogen
Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′)
Forward Primer 27f (5′ Agr Gtt Tga Tcm Tgg Ctc Ag 3′), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′)/product/Illumina Inc
Average 90 stars, based on 1 article reviews
forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc forward primers 27f with golay barcodes containing a specific illumina 5’ adapter
Forward Primers 27f With Golay Barcodes Containing A Specific Illumina 5’ Adapter, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primers 27f with golay barcodes containing a specific illumina 5’ adapter/product/Illumina Inc
Average 90 stars, based on 1 article reviews
forward primers 27f with golay barcodes containing a specific illumina 5’ adapter - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag bacterial forward primer 27f labelled hexafluorescein (hex
Bacterial Forward Primer 27f Labelled Hexafluorescein (Hex, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bacterial forward primer 27f labelled hexafluorescein (hex/product/MWG-Biotech ag
Average 90 stars, based on 1 article reviews
bacterial forward primer 27f labelled hexafluorescein (hex - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG forward primer 27 f
Forward Primer 27 F, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27 f/product/Metabion International AG
Average 90 stars, based on 1 article reviews
forward primer 27 f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GATC Biotech forward primer 27f
Forward Primer 27f, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f/product/GATC Biotech
Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins primers forward 16s_27_f
Primers Forward 16s 27 F, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers forward 16s_27_f/product/Eurofins
Average 90 stars, based on 1 article reviews
primers forward 16s_27_f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39
Forward Primer 27f 59 Aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag 39, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39/product/Illumina Inc
Average 90 stars, based on 1 article reviews
forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bioneer Corporation forward primer 27f
Forward Primer 27f, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 27f/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results