90
|
STAB VIDA
forward primer 27f Forward Primer 27f, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f/product/STAB VIDA Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
27f-illumina forward primer 27f Illumina Forward Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/27f-illumina forward primer/product/Illumina Inc Average 90 stars, based on 1 article reviews
27f-illumina forward primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pacific Biosciences
forward primer 27f 5′- agrgttygatymtggctcag- 3′ Forward Primer 27f 5′ Agrgttygatymtggctcag 3′, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f 5′- agrgttygatymtggctcag- 3′/product/Pacific Biosciences Average 90 stars, based on 1 article reviews
forward primer 27f 5′- agrgttygatymtggctcag- 3′ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Macrogen
forward primer 27f Forward Primer 27f, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f/product/Macrogen Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′) Forward Primer 27f (5′ Agr Gtt Tga Tcm Tgg Ctc Ag 3′), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′)/product/Illumina Inc Average 90 stars, based on 1 article reviews
forward primer 27f (5′-agr gtt tga tcm tgg ctc ag-3′) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
forward primers 27f with golay barcodes containing a specific illumina 5’ adapter Forward Primers 27f With Golay Barcodes Containing A Specific Illumina 5’ Adapter, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primers 27f with golay barcodes containing a specific illumina 5’ adapter/product/Illumina Inc Average 90 stars, based on 1 article reviews
forward primers 27f with golay barcodes containing a specific illumina 5’ adapter - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
bacterial forward primer 27f labelled hexafluorescein (hex Bacterial Forward Primer 27f Labelled Hexafluorescein (Hex, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bacterial forward primer 27f labelled hexafluorescein (hex/product/MWG-Biotech ag Average 90 stars, based on 1 article reviews
bacterial forward primer 27f labelled hexafluorescein (hex - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
forward primer 27 f Forward Primer 27 F, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27 f/product/Metabion International AG Average 90 stars, based on 1 article reviews
forward primer 27 f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
forward primer 27f Forward Primer 27f, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f/product/GATC Biotech Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
primers forward 16s_27_f Primers Forward 16s 27 F, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers forward 16s_27_f/product/Eurofins Average 90 stars, based on 1 article reviews
primers forward 16s_27_f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39 Forward Primer 27f 59 Aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag 39, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39/product/Illumina Inc Average 90 stars, based on 1 article reviews
forward primer 27f 59-aatgatacggcgaccaccgagatctacacxxxxxxxxtatggtaattgtagagtttgatcctggctcag-39 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Bioneer Corporation
forward primer 27f Forward Primer 27f, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 27f/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
forward primer 27f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |